igf1r β primary antibody  (Cell Signaling Technology Inc)

Journal: Endocrinology

Article Title: IGF1 Signaling Regulates Neuropeptide Expression in Hypothalamic Neurons Under Physiological and Pathological Conditions

doi: 10.1210/endocr/bqaf051

Figure Lengend Snippet: List of antibodies for Western blots

Article Snippet: IGF1R-β Primary Antibody , Cell Signaling Technology , 3027 RRID:AB_2122378.

Techniques: Western Blot

Journal: The FASEB Journal

Article Title: Impaired myoblast differentiation and muscle IGF‐1 receptor signaling pathway activation after N‐glycosylation inhibition

doi: 10.1096/fj.202400213rr

Figure Lengend Snippet: FIGURE 4 IGF-1 production and IGF1R signaling pathway activation in TA muscle of WT and MLC/mIgf-1 mice treatment with low TUN dose (0.1 mg/kg of TUN for 15 days). (A) Expression of endogenous Igf-1 mRNA isoforms (i.e., Igf-1Ea and Igf-1Ec mRNAs) and total Igf-1 (i.e., endogenous and mIgf-1 transgene mRNAs) in the TA muscle of WT (n = 3) and MLC/mIgf-1 (n = 3) mice treated with TUN. (B) Representative immunoblotting and (C) band densitometry analysis of TA muscle of WT and MLC/mIgf1 mice using an antibody directed against mature mouse IGF-1 sequence. Three bands at a molecular weight of ~22, ~17, and ~12 kDa were detected in TA muscle of MLC/ mIgf1 mice. Recombinant mouse IGF-1 mature protein was loaded as a positive control for mature IGF-1 (~7 kDa). (D) Representative immunoblotting and (E) band densitometry analysis of TA muscle of WT and MLC/mIgf1 mice using antibodies directed against phosphorylated (pIGF1R) and total IGF1R, phosphorylated (pAKT) and total AKT, and phosphorylated (pERK1/2) and total ERK1/2. All bar charts are presented as mean values ± SD. Significant differences were determined using unpaired t-test (C) or two-way ANOVA followed by Tukey's multiple comparison post hoc tests (A, E). *Significantly different compared to CTR; #Significantly different compared to WT mice; * and # p ≤ .05; ** p ≤ .01 *** and ### p ≤ .001.

Article Snippet: Primary antibodies against phospho- IGF1R β (1:2000; cat. n. 3024 Cell Signaling Technology), total IGF1R β (1:2000; cat. n. 3027 Cell Signaling Technology), phospho- Akt (Ser473) (1:2000; cat. n. 9271 Cell Signaling Technology), total Akt (1:2000; cat. n. 9272 Cell Signaling Technology), phospho- p44/42 (ERK1/2) (1:2000; cat. n. 9101 Cell Signaling Technology), total p44/42 (ERK1/2) (1:2000; cat. n. 9102 Cell Signaling Technology), PCNA (1:5000, cat. n. MAB 424R Millipore), MF20 (1:500, DSHB), and mouse/rat biotinylated IGF- 1 antibody (1:300, cat. n. BAF791 R&D Systems) were incubated overnight at 4°C.

Techniques: Activation Assay, Expressing, Western Blot, Sequencing, Molecular Weight, Recombinant, Positive Control, Comparison

Journal: The FASEB Journal

Article Title: Impaired myoblast differentiation and muscle IGF‐1 receptor signaling pathway activation after N‐glycosylation inhibition

doi: 10.1096/fj.202400213rr

Figure Lengend Snippet: FIGURE 5 Effect of TUN treatment on IGF1R production and IGF1R signaling pathway activation in C2C12. (A) IGF1R and IGF1R proreceptor production in C2C12 cells treated with 0.01 μg/mL of TUN and harvested at day 1. (B) Immunofluorescence analysis of C2C12 cells stained with ant-IGF1R and DAPI, the scale bar represents 200 μm. (C) Representative immunoblotting and (D) band densitometry analysis of IGF-1-induced IGF-1R signaling pathway activation in CTR- and TUN-treated C2C12 cells using antibodies directed against phosphorylated (pIGF1R) and total IGF1R, phosphorylated (pAKT) and total AKT, and phosphorylated (pERK1/2) and total ERK1/2. The calculation of pIGF1R level was normalized against total lysed protein instead of total IGF1R to account for the marked reduction of total IGF1R after TUN treatment. All bar charts are presented as mean values ± SD. Significant differences were determined using unpaired t-test (A) or one-way ANOVA followed by Tukey's multiple comparison post hoc tests (D). *Significantly different compared to CTR, #Significantly different compared to IGF-1-treated cells; ** p ≤ .01, *** p ≤ .001; ## p ≤ .01, ### p ≤ .001.

Article Snippet: Primary antibodies against phospho- IGF1R β (1:2000; cat. n. 3024 Cell Signaling Technology), total IGF1R β (1:2000; cat. n. 3027 Cell Signaling Technology), phospho- Akt (Ser473) (1:2000; cat. n. 9271 Cell Signaling Technology), total Akt (1:2000; cat. n. 9272 Cell Signaling Technology), phospho- p44/42 (ERK1/2) (1:2000; cat. n. 9101 Cell Signaling Technology), total p44/42 (ERK1/2) (1:2000; cat. n. 9102 Cell Signaling Technology), PCNA (1:5000, cat. n. MAB 424R Millipore), MF20 (1:500, DSHB), and mouse/rat biotinylated IGF- 1 antibody (1:300, cat. n. BAF791 R&D Systems) were incubated overnight at 4°C.

Techniques: Activation Assay, Immunofluorescence, Staining, Western Blot, Comparison

Journal: Oncotarget

Article Title: Let-7c inhibits migration and epithelial–mesenchymal transition in head and neck squamous cell carcinoma by targeting IGF1R and HMGA2

doi: 10.18632/oncotarget.23826

Figure Lengend Snippet: Relative protein levels of ( A ) IGF1R and HMGA2. IGF1R and HMGA2 in HNSCC tumor tissues and adjacent non-tumor tissues ( n = 15) were examined by western blot analysis with GAPDH serving as loading control. Thereafter, the target protein levels were calculated as fold change compared to paired non-tumor levels. Non-tumor levels were set as 1. Statistical analysis was performed using the Student’s paired t -test. ( B ) Representative IHC staining of IGF1R and HMGA2 in HNSCC tumor tissues and adjacent non-tumor tissues. Original magnification ×100 and ×200; bar represents 50 μm. Expression of ( C ) Let-7c, ( D ) IGF1R , and ( E ) HMGA2 in HNSCC cell lines SAS, Ca9-22, and H0-1-u-1 compared to non-malignant nasopharyngeal epithelial cell line NP69. Let-7c-binding sites in the IGF1R and HMGA2 3′-UTRs were predicted by TargetScan. ( F ) 2619–2626nt of the IGF1R 3′-UTR sequence and ( G ) 21–28nt of the HMGA2 3′-UTR sequence, as well as the complementary let-7c binding sequences and the target mutated sequences, are shown in the boxed rectangles. For the luciferase reporter assays, SAS cells were co-transfected with 50 ng of PCMV-MIR vector or PCMV-MIR-let-7c vector and 100 ng dual-luciferase vector containing either wild-type or mutant 3′-UTR of (F) IGF1R and (G) HMGA2 . The relative firefly luciferase activity normalized with renilla luciferase was measured 24 h after transfection. Statistical analysis was performed using the Student’s t -test. * P < 0.05; ** P < 0.01; *** P < 0.001.

Article Snippet: Primary antibodies against IGF1R-β (1:1000, #9750), HMGA2 (1:1000, #8179), E-cadherin (1:1000, #3195), and vimentin (1:1000, #5741) were obtained from Cell Signaling Technology.

Techniques: Western Blot, Control, Immunohistochemistry, Expressing, Binding Assay, Sequencing, Luciferase, Transfection, Plasmid Preparation, Mutagenesis, Activity Assay

Journal: Oncotarget

Article Title: Let-7c inhibits migration and epithelial–mesenchymal transition in head and neck squamous cell carcinoma by targeting IGF1R and HMGA2

doi: 10.18632/oncotarget.23826

Figure Lengend Snippet: HNSCC cells were stably transfected with either pCMV-MIR vector or pCMV-MIR-let-7c vector. Expression levels of ( A, B ) let-7c and ( C, D ) IGF1R and HMGA2 mRNA were examined in HNSCC cell lines SAS and Ca9-22, respectively, with RT-qPCR. ( E, F ) IGF1R and HMGA2 protein levels were examined by western blot analysis in stably transfected let-7-expressing SAS and Ca9-22 cell lines, respectively, with GAPDH serving as loading control. P -values were calculated using the Student’s t -test. *** P < 0.001.

Article Snippet: Primary antibodies against IGF1R-β (1:1000, #9750), HMGA2 (1:1000, #8179), E-cadherin (1:1000, #3195), and vimentin (1:1000, #5741) were obtained from Cell Signaling Technology.

Techniques: Stable Transfection, Transfection, Plasmid Preparation, Expressing, Quantitative RT-PCR, Western Blot, Control

Journal: Oncotarget

Article Title: Let-7c inhibits migration and epithelial–mesenchymal transition in head and neck squamous cell carcinoma by targeting IGF1R and HMGA2

doi: 10.18632/oncotarget.23826

Figure Lengend Snippet: HNSCC cell lines SAS and Ca9-22 were transfected with either pCMV-MIR vector or pCMV-MIR-let-7c vector. Cells were subjected to assays of ( A, B ) colony formation, ( C, D ) proliferation, and ( E ) migration to examine growth of in vitro cancer cell cultures. P -values were calculated using the Student’s t -test. Following re-expression of IGF1R or HMGA2 in SAS-let-7c cells using pCMV6-IGF1R or pCMV6-HMGA2, cells were subjected to assays of ( F ) proliferation and ( G ) migration. P -values of F and G were derived from two-way ANOVA and one-way ANOVA followed by Bonferroni correction, respectively. * P < 0.05; ** P < 0.01; *** P < 0.001.

Article Snippet: Primary antibodies against IGF1R-β (1:1000, #9750), HMGA2 (1:1000, #8179), E-cadherin (1:1000, #3195), and vimentin (1:1000, #5741) were obtained from Cell Signaling Technology.

Techniques: Transfection, Plasmid Preparation, Migration, In Vitro, Expressing, Derivative Assay

Journal: Oncotarget

Article Title: Let-7c inhibits migration and epithelial–mesenchymal transition in head and neck squamous cell carcinoma by targeting IGF1R and HMGA2

doi: 10.18632/oncotarget.23826

Figure Lengend Snippet: ( A ) Growth curves were drawn by measuring tumor volumes at the indicated times. ( B ) Image of subcutaneous xenografts in the mouse flanks (the arrows indicate tumor locations in a mouse injected with (L) SAS cells stably expressing let-7c or (R) control SAS cells) and excised tumors. ( C ) Weight of xenograft tumors. ( D ) H&E staining demonstrating growth properties. Arrows point to blood vessels in the cancer nests. ( E ) Representative IHC staining of IGF1R, HMGA2, E-cadherin, and vimentin in the xenograft tumors. Nuclei were counterstained with hematoxylin. Original magnification ×100 and ×200; bars represent 50 μm. P -values of differences between let-7c and control tumors were calculated using the Student’s paired t -test. * P < 0.05, ** P < 0.01, *** P < 0.001.

Article Snippet: Primary antibodies against IGF1R-β (1:1000, #9750), HMGA2 (1:1000, #8179), E-cadherin (1:1000, #3195), and vimentin (1:1000, #5741) were obtained from Cell Signaling Technology.

Techniques: Injection, Stable Transfection, Expressing, Control, Staining, Immunohistochemistry

Journal: Oncotarget

Article Title: Let-7c inhibits migration and epithelial–mesenchymal transition in head and neck squamous cell carcinoma by targeting IGF1R and HMGA2

doi: 10.18632/oncotarget.23826

Figure Lengend Snippet: IGF1R and HMGA2 were knocked down using siRNAs in the HNSCC cell line SAS. Cells were subjected to assays of ( A ) colony formation, ( B ) proliferation, and ( C ) migration to examine growth of in vitro cancer cell cultures. ( D, E ) Levels of EMT-related proteins E-cadherin and vimentin were determined by western blot in SAS cells transfected with (D) IGF1R siRNA or (E) HMGA2. P -values of A and C were achieved using one-way ANOVA, followed by Bonferroni correction. (B, D, E) P -values were calculated using the Student’s t -test. * P < 0.05; ** P < 0.01; *** P < 0.001.

Article Snippet: Primary antibodies against IGF1R-β (1:1000, #9750), HMGA2 (1:1000, #8179), E-cadherin (1:1000, #3195), and vimentin (1:1000, #5741) were obtained from Cell Signaling Technology.

Techniques: Migration, In Vitro, Western Blot, Transfection

Journal: Cancer Science

Article Title: Basal expression of insulin-like growth factor 1 receptor determines intrinsic resistance of cancer cells to a phosphatidylinositol 3-kinase inhibitor ZSTK474

doi: 10.1111/cas.12582

Figure Lengend Snippet: Basal expression levels of insulin-like growth factor 1 receptor (IGF1R) protein and the correlation with intrinsic resistance to ZSTK474 in JFCR39 cell lines. (a) Cells without ZSTK474 treatment were harvested and the expression of IGF1R protein in each of the JFCR39 cell lines was examined by immunoblot analysis. Expression level of IGF1R in each sample was normalized to that in the “control” sample (mixture of lysates prepared from all 39 cells). Quantitative data are median values of three independent experiments; images show representative results. (b) Correlation between GI 50 concentrations of ZSTK474 and IGF1R protein expression across the JFCR39 cancer cell lines. Pearson correlation coefficients and P -values were calculated for demonstrating statistical significance.

Article Snippet: Immunoblot assays were carried out on cell extracts as described previously using a primary antibody for IGF1R-β (#3018), phosphorylated IGF1R at Tyr1135 (#3918), phosphorylated Akt at Thr308 (#4056) or Ser473 (#4058), phosphorylated ribosomal S6 protein at Ser235/236 (#4858), insulin receptor substrate 1 (IRS1; #2382), phosphorylated IRS1 at Ser636/639 (#2388) (Cell Signaling Technology, Danvers, MA, USA), and phosphorylated IRS1 at Tyr612 (44816G) (Invitrogen, Carlsbad, CA, USA) as the probe.

Techniques: Expressing, Western Blot, Control

Journal: Cancer Science

Article Title: Basal expression of insulin-like growth factor 1 receptor determines intrinsic resistance of cancer cells to a phosphatidylinositol 3-kinase inhibitor ZSTK474

doi: 10.1111/cas.12582

Figure Lengend Snippet: Effect of insulin-like growth factor 1 receptor (IGF1R) siRNAs on activity of ZSTK474 to inhibit cell proliferation and phosphatidylinositol 3-kinase downstream signaling. (a) Knockdown of IGF1R protein expression using IGF1R siRNAs. MKN28, St-4, SNB75, and PC3 cells were transfected with control siRNA (si-cont.) or IGF1R siRNAs (siIGF1R-1 or siIGF1R-2) and the expression of IGF1R protein was measured by immunoblot analysis. (b) Dose–response curves of ZSTK474 against cell growth in MKN28, St-4, SNB75, and PC3 cells after transfection with control siRNA or IGF1R siRNAs. Cell growth was assessed by sulforhodamine B assay. Assays were carried out in duplicate and the data are representative of two independent experiments. (c) MKN28, St-4, SNB75, and PC3 cells were transfected with either control siRNA or IGF1R siRNA, and then exposed to ZSTK474 at the indicated concentrations for 3 h. Cells were then harvested and immunoblot analyses of indicated proteins were carried out.

Article Snippet: Immunoblot assays were carried out on cell extracts as described previously using a primary antibody for IGF1R-β (#3018), phosphorylated IGF1R at Tyr1135 (#3918), phosphorylated Akt at Thr308 (#4056) or Ser473 (#4058), phosphorylated ribosomal S6 protein at Ser235/236 (#4858), insulin receptor substrate 1 (IRS1; #2382), phosphorylated IRS1 at Ser636/639 (#2388) (Cell Signaling Technology, Danvers, MA, USA), and phosphorylated IRS1 at Tyr612 (44816G) (Invitrogen, Carlsbad, CA, USA) as the probe.

Techniques: Activity Assay, Knockdown, Expressing, Transfection, Control, Western Blot, Sulforhodamine B Assay

Journal: Cancer Science

Article Title: Basal expression of insulin-like growth factor 1 receptor determines intrinsic resistance of cancer cells to a phosphatidylinositol 3-kinase inhibitor ZSTK474

doi: 10.1111/cas.12582

Figure Lengend Snippet: Difference in antitumor efficacy of ZSTK474 between insulin-like growth factor 1 receptor (IGF1R)-positive and -negative ZSTK474-naïve human cancer xenografts. JFCR24 xenografts were divided into three groups: IGF1R-positive group (eight tumors); IGF1R-negative group (12 tumors); and the marginal group (four tumors). In vivo efficacies of ZSTK474 (treated/control [T/C] values [%] after daily treatment with 200 mg/kg for 2 weeks) were determined previously. Welch's t -test (two-sided) was used to determine the statistical significance of difference in the T/C values of ZSTK474 in the IGF1R-positive group and those in the IGF1R-negative group.

Article Snippet: Immunoblot assays were carried out on cell extracts as described previously using a primary antibody for IGF1R-β (#3018), phosphorylated IGF1R at Tyr1135 (#3918), phosphorylated Akt at Thr308 (#4056) or Ser473 (#4058), phosphorylated ribosomal S6 protein at Ser235/236 (#4858), insulin receptor substrate 1 (IRS1; #2382), phosphorylated IRS1 at Ser636/639 (#2388) (Cell Signaling Technology, Danvers, MA, USA), and phosphorylated IRS1 at Tyr612 (44816G) (Invitrogen, Carlsbad, CA, USA) as the probe.

Techniques: In Vivo, Control

Journal: Cancer Science

Article Title: Establishment of phosphatidylinositol 3‐kinase inhibitor‐resistant cancer cell lines and therapeutic strategies for overcoming the resistance

doi: 10.1111/cas.12004

Figure Lengend Snippet: Overexpression of insulin‐like growth factor 1 receptor (IGF1R) in ZSTK474‐resistant cells. (A,B) Expression levels of IGF1R in SF295, SF295‐R, SF295‐R/df3, SF295‐R/df14, and SF295‐R/df100 cells. IGF1R mRNA levels were quantified by real‐time quantitative PCR (A) and IGF1R protein levels were analyzed by immunoblot assay (B). Expression levels of IGF1R correlated well with resistance levels to ZSTK474. The present data are representative of two independent experiments. (C) Immunoblot analysis of IGF1R expression in three parental and their respective ZSTK474‐resistant cells. Expression of β‐actin was also determined to ensure equal loading of protein in each lane (control). The data are representative of two independent experiments.

Article Snippet: Immunoblot analysis Immunoblot assays were carried out on cell extracts as described previously 11 using a primary antibody for IGF1R‐β, phosphorylated IGF1R‐β at Tyr1135, phosphorylated Akt at Thr308 or Ser473, and phosphorylated ERK1/2 at Thr202/Tyr204 (Cell Signaling Technology, Danvers, MA, USA) as the probe.

Techniques: Over Expression, Expressing, Real-time Polymerase Chain Reaction, Western Blot, Control

Journal: Cancer Science

Article Title: Establishment of phosphatidylinositol 3‐kinase inhibitor‐resistant cancer cell lines and therapeutic strategies for overcoming the resistance

doi: 10.1111/cas.12004

Figure Lengend Snippet: Effect of insulin‐like growth factor 1 receptor (IGF1R) siRNAs on protein expression levels of IGF1R and sensitivity to ZSTK474 in SF295 and SF295‐R cells. (A) Expression levels of IGF1R protein were analyzed by immunoblot assay in SF295‐R and parental SF295 cells transfected with control siRNA (si‐cont) or IGF1R‐siRNA (siIGF1R‐1, 5′‐UUAAUGAGCAAAUUGCCCUUGAAGA‐3′; siIGF1R‐2, 5′‐UAAACGGUGAAGCUGAUGAGAUCCC‐3′) and incubated for 48 h. Protein levels were dramatically reduced in SF295‐R cells after 48 h incubation following transfection with IGF1R‐siRNA. (B) Effects of IGF1R siRNAs on ZSTK474 sensitivity of SF295‐R and parental SF295 cells. After transfection with siRNA, cells were incubated overnight, replated on 96‐well plates, allowed to attach overnight, then treated with the indicated concentration of ZSTK474 for 48 h. Cell growth was assessed by sulforhodamine B assay and the relative growth of the ZSTK474 treated cells compared to that of the untreated cells was calculated. SF295‐R cells transfected with IGF1R‐siRNA showed restored sensitivity to ZSTK474 comparable to that of the parental SF295 cells. Assays were carried out in duplicate and the data are representative of two independent experiments.

Article Snippet: Immunoblot analysis Immunoblot assays were carried out on cell extracts as described previously 11 using a primary antibody for IGF1R‐β, phosphorylated IGF1R‐β at Tyr1135, phosphorylated Akt at Thr308 or Ser473, and phosphorylated ERK1/2 at Thr202/Tyr204 (Cell Signaling Technology, Danvers, MA, USA) as the probe.

Techniques: Expressing, Western Blot, Transfection, Control, Incubation, Concentration Assay, Sulforhodamine B Assay

Journal: Cancer Science

Article Title: Establishment of phosphatidylinositol 3‐kinase inhibitor‐resistant cancer cell lines and therapeutic strategies for overcoming the resistance

doi: 10.1111/cas.12004

Figure Lengend Snippet: Activation status of the phosphatidylinositol 3‐kinase–Akt pathway in SF295, SF295‐R, and SF295‐R/df100 cells after exposure to ZSTK474. The cells were treated with the indicated concentrations of ZSTK474 for 3 h. Cells were harvested and immunoblot analysis of insulin‐like growth factor 1 receptor (IGF1R‐β), phosphorylated IGF1R (p‐IGF1R‐β), phosphorylated Akt (p‐Akt) at Thr308 and Ser473, and phosphorylated ERK1/2 (p‐ERK1/2) were carried out.

Article Snippet: Immunoblot analysis Immunoblot assays were carried out on cell extracts as described previously 11 using a primary antibody for IGF1R‐β, phosphorylated IGF1R‐β at Tyr1135, phosphorylated Akt at Thr308 or Ser473, and phosphorylated ERK1/2 at Thr202/Tyr204 (Cell Signaling Technology, Danvers, MA, USA) as the probe.

Techniques: Activation Assay, Western Blot

Journal: Cancer Science

Article Title: Establishment of phosphatidylinositol 3‐kinase inhibitor‐resistant cancer cell lines and therapeutic strategies for overcoming the resistance

doi: 10.1111/cas.12004

Figure Lengend Snippet: Effect of insulin‐like growth factor 1 receptor (IGF1R) siRNA on expression levels of phosho‐Akt in SF295‐R cells after exposure to ZSTK474. SF295 and SF295‐R cells were transfected with control siRNA (sicont) or IGF1R siRNA (siIGF1R‐1). Cells were then exposed to ZSTK474 at the indicated concentrations for 3 h. Cells were harvested and immunoblot analysis of IGF1R and phosphorylated Akt at Thr308 and Ser473 were carried out.

Article Snippet: Immunoblot analysis Immunoblot assays were carried out on cell extracts as described previously 11 using a primary antibody for IGF1R‐β, phosphorylated IGF1R‐β at Tyr1135, phosphorylated Akt at Thr308 or Ser473, and phosphorylated ERK1/2 at Thr202/Tyr204 (Cell Signaling Technology, Danvers, MA, USA) as the probe.

Techniques: Expressing, Transfection, Control, Western Blot